Umuwa Home
  Web     Image     Video     News  
Showing results for prsf vector

    Web Results
pRSF-1 - Addgene Vector Database (Plasmids, Expression ...
Welcome to Vector Database! Vector database is a digital collection of vector backbones assembled from publications and commercially available sources.  
pRSF and pCDF Vectors - 生物通 ...
pRSF and pCDF Vectors About the Kits pRSF Expression System 1b 1 kit 71375-3 pRSF Expression System 1b plus Competent Cells 1 kit 71376-3  
Addgene: Sus1/PRSF
Plasmid Sus1/PRSF from Dr. Cynthia Wolberger's lab contains the insert Sus1 and is published in Science. 2010 May 21. 328(5981):1025-9. This plasmid is available through Addgene.    
Novagen - Helmholtz Zentrum München
pRSF-1b Vector TB393 0903 pRSF-1b sequence landmarks T7 promoter 3653–3669 T7 transcription start 1 His•Tag ...  
PRSF | Brands of the World™ | Download vector logos and ...
Download the vector logo of the PRSF brand designed by Paulo in CorelDRAW® format. The current status of the logo is active, which means the logo is currently in use.  
pRSFDuet-1 - EcoliWiki
The Duet vectors are T7 promoter expression vectors, each designed to coexpress two target proteins in E. coli to be used together or with existing pET, pCDF, pRSF, ...  
71363 | pRSF-1b DNA,EMD...
TB401 pRSF and pCDF Vectors: Vector Map. Title; TB393VM pRSF-1b Vector Map: Vector Sequence. Title; pRSF-1b Vector Sequence: Related Products & Applications Categories. Life Science Research > Genomic Analysis > Transfection and Protein Expression > Bacterial Expression > Bacterial Expression ...  
pRSF-1b Sequence and Map - SnapGene | Software for everyday ...
pRSF-1b Bacterial vector with an RSF 1030 origin for the regulated expression of N-terminally 6xHis-tagged proteins.  
PRSF vector logo - download page - LogosVector
Logo PRSF vector download page, you can download for free, download logo PRSF, PRSF logo PRSF free logo  
DNA Preparation & Cloning | Life Science Research | Merck ...
Plasmid Vectors Competent Cells Next Generation Sequencing Transfection & Protein Expression; SmartFlare Live Cell RNA Detection; Todos los productos All DNA Preparation & Cloning Products Genomic Analysis DNA Preparation & Cloning Overview ...  
List of sequencing primers for cloning vectors and ORF ...
This is the list and sequences of sequencing primers for InvivoGen's cloning vectors and ORF vectors.  
71364 | pRSF-2 Ek/LIC Vector Kit,EMD_BIO......
pRSF-2 Ek/LIC Vector Kit ... The faster way to trouble- free high resolution separations.  
Tag: PRSF - Logo Vector Download Free (AI,EPS,CDR,SVG,PDF ...
Tag: PRSF | Archive of free downloadable vector brand, company, corporate logotypes design. (AI, EPS, CDR, PDF, GIF, SVG)    
pRSF-2 Ek/LIC - EcoliWiki
The pRSF-2 Ek/LIC Vector is a LIC-compatible derivative of pRSF-1b. This plasmid is compatible with the LIC Duet Adaptors for coexpression of two proteins as well as with pET-46 and pCDF-2 Ek/LIC vectors for coexpression of up to six proteins when using the LIC Duet Adaptors.  
DNA Preparation & Cloning | Life Science Research | EMD Millipore
Plasmid Vectors Competent Cells Next Generation Sequencing Transfection & Protein Expression; SmartFlare Live Cell RNA Detection; All Products; All DNA Preparation & Cloning Products Genomic Analysis DNA Preparation & Cloning Overview: Request ...  
pRSF-1 Expression System - 生物通 ...
The pRSF-1 Expression System contains 10 µg of pRSF-1b DNA. pRSF-1b carries an N-terminal His•Tag ® coding ... •TB393 pRSF-1b Vector Map  
Nova gen - University of Utah Biochemistry Department of ...
The vector contains two multi-ple cloning sites (MCS), each of which is preceded by a T7lac promoter and ribosome binding site (rbs). The vector also carries the RSF1030-derived RSF replicon, lacI gene and kanamycin resistance gene (KnR).  
Supporting Material. Material and Methods Plasmid Construction.
! 2! Tet vector. pRSF-protease vectors sequences and maps are listed below (see Supplementary Figs. 1 and 2). The cyclic peptide library was prepared as previously described by Tavassoli and  
EMBL Hamburg Outstation - Helmholtz Zentrum München
EMBL Hamburg Outstation expression vector map Source: Arie Geerlof  
pRSF RfA - Institut de Génétique Moléculaire de ...
pRSF RfA The pRSF RfA vector is a T7 promoter expression vector designed to express target protein in E. Coli. pRSF RfA landmarks : T7 promotor 5293-5309  
Strategies for protein coexpression in Escherichia coli
Strategies for protein coexpression in Escherichia coli Niraj H Tolia & Leemor Joshua-Tor ... vectors have two multiple cloning sites per vector, ... Coexpression of pGEX-4T-1 harboring the gene encoding GST-hAgo2 with pRSF-Duet  
Bioscience Price List 2014-15 – Volume I
These vectors differ from pET-45b(+) in that they have different. replicons and drug resistance genes. These two features make the. pCDF-1b and pRSF-1b vectors suitable for coexpression with each. other as well as with many other pET vectors. Cat. No. Product Description.  
pCOLA-2-DEST Sequence and Map - SnapGene | Software for ...
pCOLA-2-DEST™ Gateway® Nova bacterial destination vector with a ColA origin for expressing proteins tagged at the C-terminus with Strep-Tag II.  
Effendi Leonard . Joseph Chemler . Kok Hong Lim . Mattheos A ...
ally, vector pCRT7/CT was used for T/A cloning of PCR-amplified DNA (Invitrogen). Molecular cloning ... Subsequently, PcFSI was cloned into pRSF-4CL between NdeI and KpnI, resulting in plasmid pRSF-4CL-FSI. Similarly, plasmid pET-CHI-CHS was constructed by  
Mechanistic insights into the role of Hop2–Mnd1 in meiotic ...
The bacterial expression plasmids pRSF-(His) 6-Hop2 and pRSF-(His) 6-Hop2 ... (His) 6-tag into the pRSF-duet vector. Plasmids pRSF-(His) 6-Hop2 1 84 and pRSF-(His) 6-Hop2 1 125 were generated by inserting a stop codon into the Hop2 coding region of pRSF-(His) 6-Hop2. pRSF-(His) 6-Hop2-Mnd1 and ...  
Sum's MBI Page - Vector Data - pRSF-1 Ek/LIC Sequence
prsf-1 ek/lic (3829bp) ggggaattgtgagcggataacaattcccctgtagaaataattttgtttaa ctttaataaggagatataccatgggcagcagccatcaccatcatcaccac agccaggatccgaattcgagctcggcgcgcctgcaggtcgacaagcttgc ggccgcataatgcttaagtcgaacagaaagtaatcgtattgtacacggcc gcataatcgaaattaatacgactcactataggggaattgtgagcggataa ...  
Functional expression of a P450 flavonoid hydroxylase for ...
biosynthesis of plant-specific hydroxylated flavonols in Escherichia coli Effendi Leonard, Yajun Yan, Mattheos A.G. Koffas ... and Pst I sequentially in vector pETDuet-1. Plasmid pRSF-FLS-FHT was generated by inserting FLS1 between EcoR V and Kpn I, ...  
Intermolecular domain swapping induces intein-mediated ...
The expression of each precursor was under the control of either IPTG (P T7 in pRSF vector) or L-arabinose (P ara in pBAD vector), as indicated.  
Modulation of GFP fluorescence by the conformation-driven ...
Figure 5: Modulation of GFP fluorescence by the conformation-driven switch. From Intermolecular domain swapping induces intein-mediated protein alternative splicing. ... (P T7 in pRSF vector) or L-arabinose (P ara in pBAD vector), as indicated.  
Biological synthesis of 7-O-methyl Apigenin from naringenin ...
Biological synthesis of 7-O-methyl Apigenin from naringenin using escherichia coli expressing two genes. Jeon YM(1), ... The PFNS-1 gene was subcloned into the E. coli expression vector pGEX and POMT-7 was subcloned into the pRSF vector.  
Crystal structure of a heterodimer of editosome interaction ...
Crystal structure of a heterodimer of editosome interaction proteins in complex with two copies of a cross-reacting nanobody Young-Jun Park1, Els Pardon2,3, Meiting Wu1, Jan Steyaert2,3 and Wim G. J. Hol1,*  
Provitamin A Accumulation in Cassava (Manihot esculenta ...
... equivalent to cassava PSY2 were generated by overlapping extension PCR using the corresponding pRSF vectors with wild-type sequences as templates. Primers are given in Supplemental Table 3 online; positions of the first amino acid and of the A/D exchange are as follows: At-PSY, ...  
Prokaryotic Expression Vectors - UCLA Core Facility |
Prokaryotic Expression Vectors pET Vectors Vector Features Resistance Source/Notes pET3a, 3b, 3c, 3d ... Compatible with pET, pRSF, and pACYC vectors. Streptomycin Novagen Our LIC vectors (T7 and pBAD promoters) pMA506 pUC origin, pBAD promoter, His6, TEV  
Effects of cytoplasmic and periplasmic chaperones on ...
The effects of cytoplasmic and periplasmic chaperones on the secretory production of an anti-bovine ribonuclease A single-chain variable fragment ... and ligated into the NcoI-BamHI site of the pRSF-1b vector, to give the plasmid pRSF-DsbC.  
Structural characterization and inhibition of the Plasmodium ...
Structural characterization and inhibition of the Plasmodium Atg8–Atg3 interaction. ... and ligated into a modified pRSF vector with an N-terminal maltose binding protein (MBP) tag and tobacco etch virus (TEV) ... was amplified from an expression vector (generous gift of Dr. Marie Hardwick, ...  
Provitamin A Accumulation in Cassava (Manihot esculenta ...
... A/D amino acid exchange equivalent to cassava PSY2 were generated by overlapping extension PCR using the corresponding pRSF vectors with wild-type sequences as ... Two cassava promoters related to vascular expression and storage root formation. Planta 218: 192–203 ...  
TB163 Ek LIC REV K 0908 - Cal State L.A. - Instructional Web ...
pRSF-2 Ek/LIC Vector Kit 71364-3 pBAC™-2cp Ek/LIC Vector Kit 70021-3 pBACgus-2cp Ek/LIC Vector Kit 70051-3 pIEx™-1 Ek/LIC Vector Kit 71237-3 pIEx-2 Ek/LIC Vector Kit 71240-3 pIEx-3 Ek/LIC Vector Kit 71245-3 pIEx-7 Ek/LIC ...  
Construction and Fine Mapping of Recombinant Plasmids ...
the pRSF 2124 vector used for the con- struction of pTUB 2 (Miyajima et al., 1979). One plasmid, pKK 123, carries the 3.2-bp fragment, shown schematically in Fig. 1. Bernardi and Bernardi (1979) have inde- pendently constructed a ...  
Patent US7582475 - Vectors and methods for high throughput co ...
Modification of the pRSF-Duet1 vector resulted in the pDEST-CM2 vector. ... "Novagen: TB392: pCDF-1b Vector Map," 3 pages. 3 "Novagen: TB401:pRSF-1 And pCDF-1 Vectors for Coexpression." Retrieved from the Internet on May 10, 2006.    
TB384 1007 RMP - Fox Chase Cancer Center
pET-51 Ek/LIC Vector Kit 71570-3 pRSF-2 Ek/LIC Vector Kit 71364-3 pCDF-2 Ek/LIC Vector Kit 71337-3 T4 DNA Polymerase, LIC-qualified, 250 U 70099-3 Additional user-supplied reagents † TlowE buffer (10 mM Tris HCl, 0.1 mM EDTA, pH 8.0)  
pet43.1 vector_在线阅读_第7页 -文库大全
Note: USA and Canada Tel (800) 526-7319 pRSF-2 and pCDF-2 Vectors for expression in E. coli The pRSF-2 and pCDF-2 Ek/LIC carry a T7lac promoter for expression in E. coli. pRSF-2 contains the RSF1030 replicon (3-4) and a kanamycin resistance marker. pCDF-2 contains the ...  
Ek/LIC Cloning Kits - Free University of Bozen-Bolzano
provided in the pET, pCDF, and pRSF Ek/LIC Vector Kits. Origami™ B(DE3)pLacI competent cells are provi ded in the pTriEx™ Ek/LIC Vector Kit. In addition to th e expression strains provided in the vector kits, Novagen offers  
AllostericActivationoftheATPaseActivityofthe Escherichia coli ...
Co-expression Vector—The Novagen pRSF-Duet-1 (Kanr) di-cistronic vector was used to construct a co-expression system forthecomplexformedbetweenRhlBandresidues696–762of RNaseE.Thevectorconsistsoftwomultiplecloningsiteseach under the control of a T7 promoter.
The pRSF.1b expression vector from Novagen was chosen for a number of reasons. It is a high copy number plasmid, confers Kanamycin resistance, contains an RSF origin and has an inducible T7 promoter. The plasmid map of the pRSF.1b vector is shown in Figure 9.  
Supporting Information - PNAS
oned into the pRSF vector (Novagen), overexpressed separately in Rosetta 2 (DE3) cells (Novagen), and purified from inclusion bodies under denaturing conditions. TFIIA was reconstituted by refolding purified ToaIp and ToaIIp as described previously (1).  
Multiple Bands in WesternBlot - ResearchGate - Share and ...
I have a problem of developing multiple bands in my western blot PVDF membrane. I am trying to express 79, 72 and 59 kDa protein in E.coli using pRSF-DUET expression vector induced with 1mM IPTG at 27oC for 2 hours.  
Name Origin Size (kb) ter LIC Fusion Cleavage laci Signal seq.
pRSF-SL2. RSF: 2.3: Kan: SL2: yes His: TEV no none: pRSF-SL3: RSF. 2.3: Kan: SL3: yes His: TEV no none: pRSF-7. RSF: 2.5: Kan: T7 yes His: TEV no none: pRSF-7B. RSF: 3.9: Kan: T7 yes His: TEV yes none: pRSF-9. RSF: 3.6: Kan: T7 yes MBP: TEV no none: pRSF-Mocr. RSF: 2.9: Kan: T7 yes Moc: TEV no ...  
Designer Cells for Stereocomplementary De Novo Enzymatic ...
An additional single library created at position A328 with NNK degeneration using pRSF-P450-F87A vector (a pRSF-P450BM3 plasmid encoding F87A amino acid substitution previously created in our laboratory) as template,  
Prokaryotic Expression - ONWON TRADING LTD
Duet Coexpression Vectors pCDF & pRSF Expression Systems : pCDF & pRSF Expression Systems pCDF & pRSF Expression Systems plus Competent Cells : pCDF & pRSF Expression Systems plus Competent Cells pET Dsb Fusion Systems 39b and 40b : ... Prokaryotic Expression  
Paradoxical Instability–Activity Relationship Defines a ...
pAX vector (Ryu and Arnosti, 2003). Two Flag epitope tags were inserted 5 ... For bacterial expression of GST fusion proteins, the pRSF Duet-1 vector (Novagen, Darm-stadt, Germany) was modified to introduce a GST ORF followed by a ligation  

No more results ...
Copyright © 2017 Umuwa. All Rights Reserved. About us / Privacy Policy / Sitemap Most searched